Journal: Critical Care

Article Title: The early responses of VEGF and its receptors during acute lung injury: implication of VEGF in alveolar epithelial cell survival

doi: 10.1186/cc5042

Figure Lengend Snippet: Intestinal ischemia reperfusion (IIR)-induced changes of vascular endothelial growth factor receptor (VEGFR)-2 in the lung tissue and immunoblotting of VEGF and its receptors. (a) VEGFR-2 immunostaining (four animals per group). Slides (magnification 1,000×) shown are representatives of indicated groups. Positively stained cells are in brown (examples are indicated with arrowheads). In the IIR group, some of the positive cells appear to be interstitial monocytes with strong staining in the cytoplasm. (b) Quantification of VEGFR-2-positive cells per field. Ten fields were counted from each animal and four animals from each group. (c) Western blotting for VEGF and its receptors. Results from two animals per group are used as examples. The optical density of blot bands were quantified with desitometry and normalized to that of glyceraldehyde-3-phosphate dehydrogenase (GAPDH) as controls. No significant difference was found among these three groups.

Article Snippet: The slides were incubated with designated primary antibodies, with a dilution of 1:200 for VEGF (sc-507), 1:20 for VEGFR-1 (sc-316) and VEGFR-2 (sc-505) from Santa Cruz Biotechnology (Santa Cruz, CA, USA), for 32 minutes at 42°C, and then with a secondary antibody (1:600) for 20 minutes.

Techniques: Western Blot, Immunostaining, Staining

Journal: Critical Care

Article Title: The early responses of VEGF and its receptors during acute lung injury: implication of VEGF in alveolar epithelial cell survival

doi: 10.1186/cc5042

Figure Lengend Snippet: Intestinal ischemia reperfusion (IIR)-induced alveolar epithelial cell death is negatively correlated with vascular endothelial growth factor (VEGF) and vascular endothelial growth factor receptor (VEGFR)-1 expression. (a) Double fluorescents staining TUNEL (red)-cytokeratin (green). An increased number of epithelial cells (in green) undergoing cell death (in red) was detected in the IIR group. Slides shown are representatives of four animals from each group. (b) Epithelial cell death index was quantified by TUNEL-cytokeratin double positive cells over cytokeratin positive cells of each field (ten fields were quantified from each animal); * p < 0.05 compared with the control group; # p < 0.05 compared with the sham group. (c) Relationship between TUNEL-positive-epithelial cells and VEGF-positive cells. (d) Relationship between TUNEL-positive-epithelial cells and VEGFR-1-positive cells.

Article Snippet: The slides were incubated with designated primary antibodies, with a dilution of 1:200 for VEGF (sc-507), 1:20 for VEGFR-1 (sc-316) and VEGFR-2 (sc-505) from Santa Cruz Biotechnology (Santa Cruz, CA, USA), for 32 minutes at 42°C, and then with a secondary antibody (1:600) for 20 minutes.

Techniques: Expressing, Staining, TUNEL Assay, Control

Journal: Critical Care

Article Title: The early responses of VEGF and its receptors during acute lung injury: implication of VEGF in alveolar epithelial cell survival

doi: 10.1186/cc5042

Figure Lengend Snippet: Lung epithelial cell death induced by vascular endothelial growth factor (VEGF) or vascular endothelial growth factor receptor (VEGFR)-1 knock-down. Human A549 cells were cultured in 24-well plates and transfected with 50 nM of small interference RNA (siRNA) specifically against either VEGF or VEGFR-1, or with a non-specific duplex RNA (NS) as control for 24 h. (a) VEGF or VEGFR-1 siRNA induced changes in cell number and/or cell morphology in A549 cells. Pictures shown are representatives for each treatment (magnification 400×). (b) XTT assay for cell viability. The data shown are mean ± standard deviation from three separated experiments. ** p < 0.01 versus the non-specific control. (c) VEGF and VEGFR-1 immunofluorescent staining at 24 h after treatment with different RNA duplexes. Decreased staining was noted in siRNA treated cells. (d) Western blots confirmed that siRNA specifically reduced VEGF or VEGFR-1 protein expression.

Article Snippet: The slides were incubated with designated primary antibodies, with a dilution of 1:200 for VEGF (sc-507), 1:20 for VEGFR-1 (sc-316) and VEGFR-2 (sc-505) from Santa Cruz Biotechnology (Santa Cruz, CA, USA), for 32 minutes at 42°C, and then with a secondary antibody (1:600) for 20 minutes.

Techniques: Knockdown, Cell Culture, Transfection, Control, XTT Assay, Standard Deviation, Staining, Western Blot, Expressing

Journal: Biomedical Journal of Scientific & Technical Research

Article Title: "Molecular Signaling Pathway in Manganese-Induced Neurotoxicity"

doi: 10.26717/bjstr.2023.54.008490

Figure Lengend Snippet: Figure 4: A. HIF-1α silencing reduced nuclear accumulation of HIF-1 in Mn treated cells. Cells were transfected with either control siRNA or siRNA specific for HIF-1α for 24 h, followed by Mn exposure (600 µM) for 6 hrs. Expression determined by Western blotting. B. HIF-1α silencing prevented Mn-induced apoptosis. Cells were transfected with either control siRNA or siRNA specific for HIF-1α for 24 h, followed by Mn exposure (600 µM) for 6 hrs. Apoptosis determined by TUNEL staining.

Article Snippet: RNA Interference Pre-designed siRNA for HIF-1α [Santa Cruz Biotechnology, Santa Cruz, CA] was used to knock down gene expression.

Techniques: Transfection, Control, Expressing, Western Blot, TUNEL Assay, Staining

Journal: Genes & Cancer

Article Title: Differential Contribution to Neuroendocrine Tumorigenesis of Parallel Egfr Signaling in Cancer Cells and Pericytes

doi: 10.1177/1947601909358722

Figure Lengend Snippet: Egfr activity contributes to RT2 tumor growth and angiogenic switching. ( A ) Relative expression quantified by real-time quantitative PCR of Erbb family members in cDNAs derived from total RNA extracts of successive stages of pancreatic neuroendocrine tumorigenesis from RIP1-Tag2 (RT2) transgenic mice (NI = normal islets; HI = hyperplastic islets; AI = angiogenic islets; IT = islet tumors). Levels of mRNAs are expressed as a percentage of the mGus control mRNA. ( B ) Western blot analysis of protein extracts from successive stages of RT2-derived lesions. ( C ) Western blot analysis of protein extracts from RT2-derived tumors 4 h after treatment with a vehicle solution or erlotinib (80 mg/kg). ( D-F ) Comparison of the average tumor burden of RT2 mice treated daily with a control solution (vehicle) or with ( D ) gefitinib (80 mg/kg), ( E ) CI-1033 (80 mg/kg), both from 11.5 to 14.5 weeks of age, or with ( F ) erlotinib (80 mg/kg), from 12 to 16 weeks of age with an additional vehicle-treated time point at 14 weeks. ( G ) Comparison of the average number of hemorrhagic angiogenic islets per pancreas of RT2 mice treated daily with a vehicle solution or with erlotinib (80 mg/kg) or CI-1033 (80 mg/kg) from 6 to 9 weeks of age. ( N = number of animals per treatment group). * P < 0.01.

Article Snippet: Quantitative real-time PCR was performed using the following TaqMan® assays (Applied Biosystems, Foster City, CA) or specifically designed assays: Mm00433023_m1 ( Egfr/Erbb1 ), Mm00658541_m1 ( Erbb2 ), For: cgggacccaccaaggtatc/Rev:ttggtgctcagagcagatgg/Probe:fam-tcatcaagagagcgagtgggcctgg-bhq1 ( Erbb3 ), For: gctgctcaggaccaaaggac/Rev:agtaacgcaggctccactgtc/Probe:fam-ctgactgctttgcctgcatgaacttca-bhq1 ( Erbb4 ), Mm00438696_m1 ( Egf ), Mm00437583_m1 ( Areg ), Mm00504344_m1 ( Epg ), Mm00446231_m1 ( Tgfa ), Mm00514794_m1 ( Epr ), Mm00432137_m1 ( Btc ), Mm00439307_m1 ( Hb-egf/Dtr ), Mm00626552_m1 ( Nrg-1 ), For:aatggaggcgtgtgctactaca/Rev:ccgaagaatccgtttggaca/Probe:fam-cgaaggcatcaaccaactctcctgca-bhq1 ( Nrg-2a ), For: tggaggcgtgtgctactacatc/Rev:cccggtgtatcccacagg/Probe: fam-aaggcatcaaccaactctcctgcaagtg-bhq1 ( Nrg-2b ), Mm004- 35367_m1 ( Nrg-3 ), Mm00446254_m1 ( Nrg-4 ), Hs01076092_m1 (Human EGFR), Hs00961131_m1 (Human HBEGF), Hs00177401_m1 (Human TGF-α), For:ctcatctggaatttcgccga/Rev:ggcgagtgaagatccccttc/Probe:fam-cgaaccagtcaccgctgagagtaatcg-bhq1 ( mGus ), Mm00435546_m1 ( PDGFR -β), Mm00476702_m1 ( Pecam1/CD31 ), and Mm00448463_m1 ( Ptprt/CD45 ).

Techniques: Activity Assay, Expressing, Real-time Polymerase Chain Reaction, Derivative Assay, Transgenic Assay, Control, Western Blot, Comparison

Journal: Genes & Cancer

Article Title: Differential Contribution to Neuroendocrine Tumorigenesis of Parallel Egfr Signaling in Cancer Cells and Pericytes

doi: 10.1177/1947601909358722

Figure Lengend Snippet: Phenotype of epidermal growth factor receptor (EGFR) inhibitor-treated pancreatic neuroendocrine tumorigenesis (PNET) tumors from RT2 mice. ( A ) Average percentage of dividing tumor cells (BrdU-positive) in vehicle- or erlotinib-treated mice following 1 week of treatment. ( B-C ) Representative micrographs of tumors from ( B ) vehicle- or ( C ) erlotinib-treated RT2 mice stained with an anti-BrdU antibody (200x). ( D ) Average percentage of apoptotic tumor cells (TdT-mediated dUTP-biotin nick end-labeling [TUNEL] positive) in tumors from vehicle- or erlotinib-treated mice following 1 week of treatment. ( E-F ) Representative micrographs of ( E ) vehicle- or ( F ) erlotinib-treated tumors stained with an anti-digoxigenin antibody following Tunel procedure (200x). ( G ) Average number of blood vessels per field (FITC-positive continuous segments) in vehicle- or erlotinib-treated mice following 1 week of treatment. ( H-I ) Representative micrographs of ( H ) vehicle- or ( I ) erlotinib-treated tumors that were collected following systemic perfusion with FITC-lectin to visualize the functional tumor vasculature (green); counterstaining with DAPI reveals the cellularity (blue) (200x). The panels are representative of 2 fields of tissue sections obtained from tumors in at least 4 treated RT2 mice. ( N = number of independent tumors analyzed per treatment group). * P < 0.001. ** P < 0.02.

Article Snippet: Quantitative real-time PCR was performed using the following TaqMan® assays (Applied Biosystems, Foster City, CA) or specifically designed assays: Mm00433023_m1 ( Egfr/Erbb1 ), Mm00658541_m1 ( Erbb2 ), For: cgggacccaccaaggtatc/Rev:ttggtgctcagagcagatgg/Probe:fam-tcatcaagagagcgagtgggcctgg-bhq1 ( Erbb3 ), For: gctgctcaggaccaaaggac/Rev:agtaacgcaggctccactgtc/Probe:fam-ctgactgctttgcctgcatgaacttca-bhq1 ( Erbb4 ), Mm00438696_m1 ( Egf ), Mm00437583_m1 ( Areg ), Mm00504344_m1 ( Epg ), Mm00446231_m1 ( Tgfa ), Mm00514794_m1 ( Epr ), Mm00432137_m1 ( Btc ), Mm00439307_m1 ( Hb-egf/Dtr ), Mm00626552_m1 ( Nrg-1 ), For:aatggaggcgtgtgctactaca/Rev:ccgaagaatccgtttggaca/Probe:fam-cgaaggcatcaaccaactctcctgca-bhq1 ( Nrg-2a ), For: tggaggcgtgtgctactacatc/Rev:cccggtgtatcccacagg/Probe: fam-aaggcatcaaccaactctcctgcaagtg-bhq1 ( Nrg-2b ), Mm004- 35367_m1 ( Nrg-3 ), Mm00446254_m1 ( Nrg-4 ), Hs01076092_m1 (Human EGFR), Hs00961131_m1 (Human HBEGF), Hs00177401_m1 (Human TGF-α), For:ctcatctggaatttcgccga/Rev:ggcgagtgaagatccccttc/Probe:fam-cgaaccagtcaccgctgagagtaatcg-bhq1 ( mGus ), Mm00435546_m1 ( PDGFR -β), Mm00476702_m1 ( Pecam1/CD31 ), and Mm00448463_m1 ( Ptprt/CD45 ).

Techniques: Staining, End Labeling, TUNEL Assay, Functional Assay

Journal: Genes & Cancer

Article Title: Differential Contribution to Neuroendocrine Tumorigenesis of Parallel Egfr Signaling in Cancer Cells and Pericytes

doi: 10.1177/1947601909358722

Figure Lengend Snippet: Distinct pools of Egfr activity in cancer cells and perivascular cells. ( A ) Expression of cell-type defining genes m-Insulin1 , Pecam1 , Pdgfr -β, Ptprt , and of Egfr , Hb-egf , and Tgf -α in sorted cells from RT2-derived PNET tumors (NS = nonsorted cells; EC = endothelial cells; PC = pericytes; IC = immune cells; TC = unlabeled tumor cells) relative to the expression detected in nonsorted cells (NS = 1). Gene expression in each cellular fraction was normalized to levels of Cyclophilin . ( B ) Comparison of the relative in vitro growth of 2 RT2 tumor-derived cancer cell lines (BTC3 and BTC4) following 3 days of treatment with DMSO or gefitinib 5 μM. ( C ) Anti-NG2 staining (red) reveals pericytes (200x). ( D ) Co-localization of NG2 (red) with phospho-EGFR Tyr1068 (pEgfr, green) (200x). ( E ) High magnification confocal localization reveals expression of phospho-Egfr (green) in pericytes expressing NG2 (red) (1600x). ( F ) High-magnification confocal localization of phospho-Egfr (green) and an endothelial specific marker (Meca-32, red) does not indicate Egfr activity in tumor endothelial cells (2,000x). ( C-H ) Micrographs are representative of multiple fields of more than 10 tumors from at least 3 independent RT2 mice.

Article Snippet: Quantitative real-time PCR was performed using the following TaqMan® assays (Applied Biosystems, Foster City, CA) or specifically designed assays: Mm00433023_m1 ( Egfr/Erbb1 ), Mm00658541_m1 ( Erbb2 ), For: cgggacccaccaaggtatc/Rev:ttggtgctcagagcagatgg/Probe:fam-tcatcaagagagcgagtgggcctgg-bhq1 ( Erbb3 ), For: gctgctcaggaccaaaggac/Rev:agtaacgcaggctccactgtc/Probe:fam-ctgactgctttgcctgcatgaacttca-bhq1 ( Erbb4 ), Mm00438696_m1 ( Egf ), Mm00437583_m1 ( Areg ), Mm00504344_m1 ( Epg ), Mm00446231_m1 ( Tgfa ), Mm00514794_m1 ( Epr ), Mm00432137_m1 ( Btc ), Mm00439307_m1 ( Hb-egf/Dtr ), Mm00626552_m1 ( Nrg-1 ), For:aatggaggcgtgtgctactaca/Rev:ccgaagaatccgtttggaca/Probe:fam-cgaaggcatcaaccaactctcctgca-bhq1 ( Nrg-2a ), For: tggaggcgtgtgctactacatc/Rev:cccggtgtatcccacagg/Probe: fam-aaggcatcaaccaactctcctgcaagtg-bhq1 ( Nrg-2b ), Mm004- 35367_m1 ( Nrg-3 ), Mm00446254_m1 ( Nrg-4 ), Hs01076092_m1 (Human EGFR), Hs00961131_m1 (Human HBEGF), Hs00177401_m1 (Human TGF-α), For:ctcatctggaatttcgccga/Rev:ggcgagtgaagatccccttc/Probe:fam-cgaaccagtcaccgctgagagtaatcg-bhq1 ( mGus ), Mm00435546_m1 ( PDGFR -β), Mm00476702_m1 ( Pecam1/CD31 ), and Mm00448463_m1 ( Ptprt/CD45 ).

Techniques: Activity Assay, Expressing, Derivative Assay, Gene Expression, Comparison, In Vitro, Staining, Marker

Journal: Genes & Cancer

Article Title: Differential Contribution to Neuroendocrine Tumorigenesis of Parallel Egfr Signaling in Cancer Cells and Pericytes

doi: 10.1177/1947601909358722

Figure Lengend Snippet: Contributions of Hb-egf and Egfr to pericyte coverage of the tumor neovasculature. ( A-D, G ) Pericyte coverage of the endothelium as a percentage of total vessel area in different stages and genetic contexts. ( A ) Comparison of vehicle- and erlotinib-treated tumors from 14-week-old RT2 mice. ( B ) Comparison of angiogenic islets from 9-week-old wild-type versus Hb-egf mutant RT2 mice. ( C ) Comparison of wild-type versus Hb-egf mutant tumors from 14-week-old RT2 mice. ( D ) Comparison of small wild-type and Hb-egf mutant tumors (ø < 3 mm) from 14-week-old RT2 mice. ( G ) Comparison of wild-type and mutant exocrine pancreas. ( E-F ) Representative staining of angiogenic microvessels (with Meca-32; red) and pericytes (with Desmin; green) (400x) in small ( E ) wild-type and ( F ) Hb-egf mutant tumors. ( N = number of fields of tumors or angiogenic islet analyzed per genotype or treatment group; 1-2 fields per lesion analyzed.) ( H-I ) Representative staining of a pericyte marker (NG2; red) and activated phospho-Egfr (green) in tumors from ( H ) wild-type or ( I ) Hb-egf mutant RT2 mice. Micrographs are representative of several fields of more than 10 RT2 tumors from at least 3 independent mice of each genotype. * P < 0.05. ** P < 0.01. *** P < 0.001.

Article Snippet: Quantitative real-time PCR was performed using the following TaqMan® assays (Applied Biosystems, Foster City, CA) or specifically designed assays: Mm00433023_m1 ( Egfr/Erbb1 ), Mm00658541_m1 ( Erbb2 ), For: cgggacccaccaaggtatc/Rev:ttggtgctcagagcagatgg/Probe:fam-tcatcaagagagcgagtgggcctgg-bhq1 ( Erbb3 ), For: gctgctcaggaccaaaggac/Rev:agtaacgcaggctccactgtc/Probe:fam-ctgactgctttgcctgcatgaacttca-bhq1 ( Erbb4 ), Mm00438696_m1 ( Egf ), Mm00437583_m1 ( Areg ), Mm00504344_m1 ( Epg ), Mm00446231_m1 ( Tgfa ), Mm00514794_m1 ( Epr ), Mm00432137_m1 ( Btc ), Mm00439307_m1 ( Hb-egf/Dtr ), Mm00626552_m1 ( Nrg-1 ), For:aatggaggcgtgtgctactaca/Rev:ccgaagaatccgtttggaca/Probe:fam-cgaaggcatcaaccaactctcctgca-bhq1 ( Nrg-2a ), For: tggaggcgtgtgctactacatc/Rev:cccggtgtatcccacagg/Probe: fam-aaggcatcaaccaactctcctgcaagtg-bhq1 ( Nrg-2b ), Mm004- 35367_m1 ( Nrg-3 ), Mm00446254_m1 ( Nrg-4 ), Hs01076092_m1 (Human EGFR), Hs00961131_m1 (Human HBEGF), Hs00177401_m1 (Human TGF-α), For:ctcatctggaatttcgccga/Rev:ggcgagtgaagatccccttc/Probe:fam-cgaaccagtcaccgctgagagtaatcg-bhq1 ( mGus ), Mm00435546_m1 ( PDGFR -β), Mm00476702_m1 ( Pecam1/CD31 ), and Mm00448463_m1 ( Ptprt/CD45 ).

Techniques: Comparison, Mutagenesis, Staining, Marker

Journal: Genes & Cancer

Article Title: Differential Contribution to Neuroendocrine Tumorigenesis of Parallel Egfr Signaling in Cancer Cells and Pericytes

doi: 10.1177/1947601909358722

Figure Lengend Snippet: Mesenchymal-derived Hb-egf activates Egfr inside tumor pericytes. ( A-B ) Co-staining of Hb-egf staining (red) and Meca-32 (endothelial cell marker; green) by confocal microscopy (2,520x) reveals both cancer cell expression (red) and endothelial cell co-localization (yellow) of Hb-egf. ( C ) Schematic description of the orthotopic transplant experiment aimed at assessing the contribution of mesenchymal-derived Hb-egf to the angiogenic phenotype of pancreatic neuroendocrine tumorigenesis (PNET) tumors. ( D ) Comparison of pericyte coverage of the tumor neovasculature in wild-type (wt) versus Hb-egf mutant (Hb−/−) hosts. ** P < 0.0005. (Number of tumors analyzed for each host genotype: N wt = 11, N Hb = 12.) ( E-F ) Representative staining of tumors for nuclei (DAPI; blue), NG2 (pericyte marker; red), and pEgfr (green) illustrating that the readily detectable pEgfr signal localized to pericytes in wild-type hosts (white arrows) ( E ) disappears in Hb-egf mutant hosts ( F ). pEgfr can be detected in cancer cells but at many-fold lower levels than in perivascular cells (see Supplementary Fig. S4). Micrographs are representative of 2 fields of 12 and 11 tumors obtained from wt or Hb-egf mutant hosts, respectively.

Article Snippet: Quantitative real-time PCR was performed using the following TaqMan® assays (Applied Biosystems, Foster City, CA) or specifically designed assays: Mm00433023_m1 ( Egfr/Erbb1 ), Mm00658541_m1 ( Erbb2 ), For: cgggacccaccaaggtatc/Rev:ttggtgctcagagcagatgg/Probe:fam-tcatcaagagagcgagtgggcctgg-bhq1 ( Erbb3 ), For: gctgctcaggaccaaaggac/Rev:agtaacgcaggctccactgtc/Probe:fam-ctgactgctttgcctgcatgaacttca-bhq1 ( Erbb4 ), Mm00438696_m1 ( Egf ), Mm00437583_m1 ( Areg ), Mm00504344_m1 ( Epg ), Mm00446231_m1 ( Tgfa ), Mm00514794_m1 ( Epr ), Mm00432137_m1 ( Btc ), Mm00439307_m1 ( Hb-egf/Dtr ), Mm00626552_m1 ( Nrg-1 ), For:aatggaggcgtgtgctactaca/Rev:ccgaagaatccgtttggaca/Probe:fam-cgaaggcatcaaccaactctcctgca-bhq1 ( Nrg-2a ), For: tggaggcgtgtgctactacatc/Rev:cccggtgtatcccacagg/Probe: fam-aaggcatcaaccaactctcctgcaagtg-bhq1 ( Nrg-2b ), Mm004- 35367_m1 ( Nrg-3 ), Mm00446254_m1 ( Nrg-4 ), Hs01076092_m1 (Human EGFR), Hs00961131_m1 (Human HBEGF), Hs00177401_m1 (Human TGF-α), For:ctcatctggaatttcgccga/Rev:ggcgagtgaagatccccttc/Probe:fam-cgaaccagtcaccgctgagagtaatcg-bhq1 ( mGus ), Mm00435546_m1 ( PDGFR -β), Mm00476702_m1 ( Pecam1/CD31 ), and Mm00448463_m1 ( Ptprt/CD45 ).

Techniques: Derivative Assay, Staining, Marker, Confocal Microscopy, Expressing, Comparison, Mutagenesis